Spiral

under Kim Il-Sung. A little digging, however, turned up a number of alarming details. For one, scientists at the SunAgra Institute published no papers, wrote no grants, and filed few patents. Furthermore, one of the species they studied was a rare fungus known as Fusarium spirale, a strange choice, since it was unknown outside of a four-province area of Brazil and had no apparent relevance to the Far East markets. And most alarmingly, the investor group was largely a shell. More than ninety percent of the money behind the project came from a single Japanese investor, the billionaire Hitoshi Kitano.

Kitano was running his own private Uzumaki program.

DUNNE HAD NO CHOICE BUT TO TAKE ACTION. BUT HE WAS in a bind-Kitano could burn him. Much of the information Dunne had shared over the years during their China conversations was classified, putting him in violation of the State Secrets Protection Act. It was treason, sharing NOFORN classified information with a foreign national, not to mention plotting the overthrow of a foreign government. Such a thing could get you a very long prison term, possibly even a death sentence.

Dunne had provided Kitano with classified information, and in turn Kitano had shared insider information about certain publicly traded Japanese companies. Kitano could reveal this to federal prosecutors, how Dunne, while sipping Kitano’s expensive scotch, had indiscreetly shared sensitive state secrets and subsequently made a small personal fortune in the Asian stock markets.

Dunne had one thing in his favor. The U.S. government under no circumstances wanted to draw attention to the Uzumaki. The Japanese doomsday weapon was still unknown to all but a tightly held group in the security establishment. Toloff’s program at USDA was top secret, no foreigners. If word of it got out that the United States was tinkering around with a biological weapon of that magnitude, not to mention the connection to Unit 731 and the tests on Chinese civilians, Beijing would go ballistic.

But Dunne also knew that no organization as large as Kitano’s could stay entirely on the correct side of the law. He ordered some digging done, and the next time Kitano arrived in the United States, federal marshals arrested him for tax evasion. The trial was quick and antiseptic. Kitano remained silent throughout the trial, and never took the stand in his own defense.

Dunne had made sure of that. In a private meeting at Kitano’s estate before the trial, Dunne had threatened Kitano with the biggest weapon he had. “Tangle with me at your peril. We’ll disappear the Uzumaki program and then turn over everything on you to the Chinese Ministry of State Security: the records from Ishii, the photographs, the transcripts-anything and everything that implicates you in the torture and genocide of Chinese civilians. And after they’re good and worked up, we’ll turn you over to them for prosecution of war crimes.”

That had shut Kitano up. Neither man spoke for almost a minute. Finally Kitano had said, “You have no fear that I will tell the Chinese everything?”

“You don’t seem to realize that you lack any sort of credibility-a Japanese war criminal and mass murderer trying to save his skin? Listen closely. Beat the tax charges if you can, but close down SunAgra immediately. And stay far away from the Uzumaki.”

ROBBINS PERKED UP. “LOOK. HE’S MOVING.”

Kitano stood and went over to his small desk. He took down one of the books from his shelf, tore out a blank sheet from the back, then picked up a pen and set about writing.

“Can you read that?” Dunne asked.

“It’s too far away. Let me see if I can-”

Kitano pulled his chair to the center of the cell, directly under the camera, and grabbed the page on which he had written. Then he stepped onto the chair and held up the paper so the image filled the screen.

“Shit. He knows about the camera,” Robbins said.

Dunne barely heard him. He was transfixed by the message.

I CAN TELL YOU WHO SHE IS

31

VLAD GLAZMAN TYPED AS HARPO READ OFF THE SEQUENCE from the gel. The two had finished the second round of PCR and dielectrophoresis a half-hour ago, and were recording the genetic sequence of the glowing fungus. Harpo read off the bands, calling out a sequence of A’s, C’s, T’s, and G’s that Vlad dutifully transcribed.

Harpo halted, took a great big sigh.

“That’s it?” Vlad asked.

“That’s it.”

Vlad stared at the string of letters:

GACTCGACTAGCTAGCAATTACTGATCAGCATT

TTSCCCAATGCAGCATTTTCGACTGACCCGACT

CGACTAGCTAGCAATTACTGATCAGCATTTTSC

CCAATGCAGCATTTTCGAGCAAATCAGACTCG

ACTAGCTAGCAATTACTGATCAGCATTTTSCCC

AATGCAGCATTTTCGAGACTCGACTAGCTAGCA

ATTACTGATCAGCATTTTSCCCAATGCAGCAT TTTCGA…

It ran on for three pages.

“Run it through the translator.”

Vlad hit a sequence of keys, shipping the data to a simple script translator called BabelGene, which rendered it in alphanumeric form. Each three-letter codon corresponded to a letter of the alphabet, AAA for “a,” ACA for “b,” and so on. Connor had been the one that had originally proposed the standard.

BabelGene did its job, and the screen filled with text.

The Uzumaki is an extraordinarily dangerous weaponized version of the species known as Fusarium spirale. It is highly virulent, spreading by spores that can survive in human, avian, and agricultural hosts…

“Christ,” Harpo said.

Vlad barely heard him, stunned as he read paragraph after paragraph detailing everything Connor had learned about the Uzumaki and everything he had done to try to defeat it. Not only that, but Connor said that he had one of the Uzumaki cylinders. Included in the message were the GPS coordinates of the location where it was hidden.

“Shit,” Vlad said. “Double shit.”

Vlad pushed Print. A LaserJet next to the computer fired up, spitting out a sheet of yellow paper with Connor’s revelations. Harpo grabbed the printout. “We should send this to someone.

Now. CDC. FBI. CIA. Someone.”

Vlad flipped his cellphone open. He hit Jake’s number. It rang once, then clicked off.

He tried it again. Same result.

He checked the bars. Plenty of signal. So what was wrong?

Then he heard a pop, felt a splash of liquid on his cheek.

Vlad turned.

Harpo was falling, the back of his head gone.

JAKE HEARD TWO SHOTS, THEN A QUICK BURST OF FOUR more. He pulled at the cuffs, trying desperately to get loose. He was in the passenger’s seat of the FedEx van, held by a ring and chain welded to the floorboard. Maggie and Dylan were tied up in the back. A strap of flesh-colored tape covered his mouth.

The cuffs holding him were virtually indestructible, brushed stainless steel with a rubberized lining and connected by a flexible band made from some kind of reinforced plastic. His bones would break before the cuffs would.

He watched Harpo’s house, alert for any movement inside. Then another gunshot. Jake yanked with his arms, trying to pull loose the ring in the floor, but it was no use.

Jake saw movement. Vlad shuffled around the corner of the house, dragging his right leg behind him. He looked