Dedicated
  to the officers and men, past and present,
  of the United States Submarine Force.
  And to my sister, Abby,
  for inspiring me to write.
   “We are on the precipice of the next great leap in computer technology. The chemically assembled electronic nanocomputer, or CAEN, will be billions of times faster than our current PCs and represent the forefront of artificial intelligence.”
 —Dr. Elizabeth Goode
   “There’s a fine line between right and wrong, freedom and oppression, the best of intentions and the insanity of genocide.”
 —Gunnar Wolfe
   “History is a bloodbath.”
 —Williams James
   “No snowflake in an avalanche ever feels responsible.”
 —Unknown
  
    PROLOGUE
 Identity: Stage One: am small and insignificant, stranded on the vast expanse of nature. I hope I can survive.
 —Deepak Chopra
       “Come to course zero-nine-zero, ahead one-third. Make ship’s depth fifty meters.”
 “Aye, sir, coming to course zero-nine-zero, making ship’s depth fifty meters.”
 “Engage computer.”
 “Aye, sir, computer engaged.”
 010110100100100101101101101001010110100101101010101
  001011010101101010101110010101100101010110100101101010
  110110111101001010110101011010010101101001010100101
 “Mr. Chau. Prepare to bring Sorceress on-line. Flood nutrient womb. Prepare bacteria for injection.”
 “Aye, sir. Nutrient womb flooded. Bacteria ready for injection.”
 “Inject bacteria into womb. Engage DNA synthesizers.”
 “Aye, sir. Injecting bacteria. Engaging DNA synthesizers.”
 0101101001011010100101011010 1011010 1 1 0 0 1 0 1 ATCGATC-
  GATATACCAG
 “Activate sensor orbs. Activate voice recognition and response programs.”
 “Aye, sir. Sensor orbs activated. Voice recognition and response programs on-line.”
 “Transfer primary ship’s control to computer. Sorceress, this is Covah. Are you on- line?”
 AACGTTTGTACCACATTAGGATACACATTAGGATA ACA GT A A
  TG C A A
 “Sorceress, acknowledge.”
 ACKNOWLEDGED. SORCERESS ON-LINE.
     “The people who get on in this world are the people who get up and look for the circumstances they want, and if they can’t find them—make them.”
 —George Bernard Shaw
   “Revolutions happen, above all, in the minds of men.”
 —Ralph Peters, “Fighting for the Future”
   “Do we have to shed blood to reform the current political system? I hope it doesn’t have to come